COW-VLEDO4U4Z
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRBV7-1*01: a Bos taurus TRB V allele sequence, 290 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Bos taurus (NCBITAXON:9913) |
|---|---|
| Locus / type | TRB / V |
| Functional i | True |
| Length | 290 nt |
| Protein UID i | COW-VP-QGOOEE (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (COW-VLEDO4U4Z). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRBV7-1*01 | IMGT | IMGT |
External records i
IMGT: TRBV7-1*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 26962778 | High Throughput Sequencing of T Cell Antigen Receptors Reveals a Conserved TCR Repertoire. | name mentioned* | literature_supp |
| 34845983 | TCR meta-clonotypes for biomarker discovery with tcrdist3 enabled identification of public, HLA-restricted clusters of SARS-CoV-2 TCRs. | name mentioned* | literature_supp |
| 40186144 | scTCR-seq and HTS reveal a special novel TRBD2-TRBJ1 rearrangement in mammalian TRB CDR3 repertoire. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 41096855 | A High-Throughput Sequencing Strategy for Clinical Repertoire Profiling of T Cell Receptor Beta Chain: Development and Reference Values Across Healthy Adults, Paediatrics, and Cord Blood Units. | name mentioned* | literature_supp |
| 41941497 | Pigs lacking Natural Killer T cells have altered cellular responses to influenza. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGCGCAGCACAGTCGCCTCCTTCCTGTTCACAAACC | IMGT | COW-R4EKPQ |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGGCTCCAGGCTCCTCTGCTGGGCGACCCTCTGTCTCCTGGGGGTGGGTCACACAGGA | 49 + 11 nt | IMGT | COW-LSBZRK |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/COW-VLEDO4U4Z/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases