CYNO-VC3H7F2TT
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV3-5*01: a Macaca fascicularis IGH V allele sequence, 302 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca fascicularis (NCBITAXON:9541) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 302 nt |
| Protein UID i | CYNO-VP-XPJEKL (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (CYNO-VC3H7F2TT). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-5*01 | IMGT | IMGT |
External records i
IMGT: IGHV3-5*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29545792 | Coupling of Single Molecule, Long Read Sequencing with IMGT/HighV-QUEST Analysis Expedites Identification of SIV gp140-Specific Antibodies from scFv Phage Display Libraries. | name mentioned* | literature_supp |
| 35419009 | Addressing IGHV Gene Structural Diversity Enhances Immunoglobulin Repertoire Analysis: Lessons From Rhesus Macaque. | name mentioned* | literature_supp |
| 38961347 | Systematic characterization of immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic cod (Gadus morhua). | name mentioned* | literature_supp |
| 39068149 | Multi-compartmental diversification of neutralizing antibody lineages dissected in SARS-CoV-2 spike-immunized macaques. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 41392054 | Necessity of individual VDJ-databases for annotating antibody heavy chain characteristics in non-human primates. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
| 41876881 | Development of canine parvovirus-neutralizing monoclonal antibodies from natural host and their germline gene usage. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAGGTCAGTGTGAGCCCAGACGGAAACC | IMGT | CYNO-R5ZC23 |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGAGTTTGTACTGAGCTGGGTTTTCCTTGTTGCCATTTTAAAAGGTGTCCAGTGT | 46 + 11 nt | IMGT | CYNO-LQVEDG |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/CYNO-VC3H7F2TT/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases