DOLPHIN-J5IVP6PD6
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRAJ42*01: a Tursiops truncatus TRA J allele sequence, 64 nt, functional. The nucleotide sequence is below, with every recorded name and its source.
| Species | Tursiops truncatus (NCBITAXON:9739) |
|---|---|
| Locus / type | TRA / J |
| Functional i | True |
| Length | 64 nt |
Coding sequence (nt)
Name history i: formerly TRAJ43*01 (to 2018-09-27);
Allele names i
Every name below denotes this exact sequence (DOLPHIN-J5IVP6PD6). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRAJ42*01 | IMGT | IMGT |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| TRAJ43*01 | 2018-09-27 |
External records i
IMGT: TRAJ42*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| j_rs | GATTACTGTGAGGCCCCATATGACTGTG | IMGT | DOLPHIN-RBBQZE |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/DOLPHIN-J5IVP6PD6/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases