FERRET-CKHD4QGM7

AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.

SpeciesMustela putorius LocusIGH TypeC FunctionalNone Length999 nt

IGHG2*01: a Mustela putorius IGH C allele sequence, 999 nt, not recorded. The nucleotide sequence is below, with every recorded name and its source.

Species	Mustela putorius (NCBITAXON:9668)
Locus / type	IGH / C
Functional i	None
Length	999 nt

Coding sequence (nt)

IMGT publishes this constant region as separate domain records, not as one sequence. What is shown here is those domains concatenated in domain order: CH1:292 + H:57 + CH2:324 + CH3-CHS:326, which is the secreted form. The membrane-bound form uses different 3' exons and is a separate transcript, not represented here.

999 nt c_secreted

CTTCCACCACGGCCCCATCGGTTTTCCCACTGGCCCCCAGCTGCGGGGGCCACCCCCGGATCCACAGTGGCCCTGGCCTGCCTGGTGTCCGGCTACTTCCCTGAGCCTGTCACTGTGTCCTGGAACTCCGGCTCCTTGACCAGCGGTGTGCACACCTTCCCGTCTGTCCTGCAGTCCTCGGGCCTCTACTCTCTCAGCAGCATGGTGACCGTGCCCTCCAGCAGGTGGCCCAGCGACACCTTCATCTGCACCGTGGCCCACCCAGCCAGTAACACCAAGGTGGACAAGAGAGTGACCCAAGGAGGACCTCCTCACACTGACCCATGCAAAAAATGTCCCCAACCTCCAGCATGTGATATGCTCGGAGGACCTTCAGTCTTCATGTTCCCCCCGAAACCCAAGGACACCCTCTCCATTTCCCGAACCCCCGAGGTTACATGCATGGTGGTGGACCTGGAAGACCCTGAGGTCCAGATCAGCTGGTTTGTGGACAACCAGGAGGTGCACGCGGCCAAGACGAATTCGCGTGAGCAGCAGTTCAACAGCACCTTCCGTGTGGTCAGTGTCCTCCCCATCCAGCACCAGGACTGGCTCAAGGGGAAGGTCTTCAAGTGCAAGGTCAACAACAAAGCTCTCCCATCCCCCATTGAGAGGACCATCTCCAAGGCCAGAGGGGAACCCCATCAGCCCAGTGTGTATGTCCTGCCCCCACCCCGGGACGAGATGAGCAGGACCACCATCAGTGTGACCTGCCTGGTCAAAGACTTCTACCCACCTGACATCGATGTGGAGTGGCAGAGCAACGGCCGTCAGTTACCAGAGGCCAGTGTCCGAACAACCCCGCCCCAGCTGGATGCGGACGGCAGCTACTTCCTCTACAGCAAGCTCTCCGTGGACAAGGCGCACTGGCAGCGGGGAGACACCTTCACGTGTGCGGTGCTGCATGAAGCCCTACACAACCATCACACGCAGAAGTCCATCTCCCAGTCTCCGGGTAAA

Name history i: stable — no former names, re-cuts, or archival on record.

Allele names i

Every name below denotes this exact sequence (FERRET-CKHD4QGM7). None is canonical; they are labels, and the UID is the key.

Name	Scheme	Source(s)
IGHG2*01	IMGT	IMGT

External records i

IMGT: IGHG2*01

Literature references 1 total · 1 sequence-in-paper i

PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence.

PMID	Title	Evidence	Source
40116504	Development of ferret immune repertoire reference resources and single-cell-based high-throughput profiling assays.	sequence in paper	literature_supp

Contributed by IMGT. See Sources & citations for each source's version, citation and licence.

Find similar (nt · aa · cross-species) i

Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.

Ranks coding alleles by normalized edit-distance identity. Also available at /api/sequences/FERRET-CKHD4QGM7/similar?min_identity=0.95&kind=nt.

API: JSON · AIRR AlleleDescription · aliases