HORSE-JL4R7EVIU
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHJ6-3*01, IGHJ6-4*01: a Equus caballus IGH J allele sequence, 54 nt, functional. The nucleotide sequence is below, with every recorded name and its source.
| Species | Equus caballus (NCBITAXON:9796) |
|---|---|
| Locus / type | IGH / J |
| Functional i | True |
| Length | 54 nt |
Coding sequence (nt)
Name history i: formerly IGHJ8*01 (to 2020-01-31); formerly IGHJ9*01 (to 2020-01-31);
Allele names i
Every name below denotes this exact sequence (HORSE-JL4R7EVIU). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGHJ6-3*01, IGHJ6-4*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHJ6-3*01 | IMGT | IMGT |
| IGHJ6-4*01 | IMGT | IMGT |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGHJ8*01 | 2020-01-31 |
| IGHJ9*01 | 2020-01-31 |
External records i
IMGT: IGHJ6-3*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| j_rs | GGTTTTTGTGGAGTGAGGATGGGACAGGCCACCATTGTG | IMGT | HORSE-R6F7DO |
| j_rs | CAGGAGCTCGGAGTGAGGATGGGACAGGCCACCATTGTG | IMGT | HORSE-RSHYC3 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HORSE-JL4R7EVIU/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases