HORSE-VVXIL5GYQ
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV7-34*01, IGHV7-34D*01: a Equus caballus IGH V allele sequence, 296 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Equus caballus (NCBITAXON:9796) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 296 nt |
| Protein UID i | HORSE-VP-T2IZEU (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: formerly IGHV7-36*01 (to 2020-01-31); formerly IGHV7-36D*01 (to 2020-01-31);
Allele names i
Every name below denotes this exact sequence (HORSE-VVXIL5GYQ). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGHV7-34*01, IGHV7-34D*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV7-34*01 | IMGT | IMGT |
| IGHV7-34D*01 | IMGT | IMGT |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGHV7-36*01 | 2020-01-31 |
| IGHV7-36D*01 | 2020-01-31 |
External records i
IMGT: IGHV7-34*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGCGTGATAACCCACATCCTGTGTGTGTCCAAAACG | IMGT | HORSE-RMTRVB |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGACTGGAGATGGTGCATCCTCTTCTTGGTGGCACTGGCTACAGGTGTCCACGCC | 46 + 11 nt | IMGT | HORSE-LIGV7D |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HORSE-VVXIL5GYQ/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases