HUMAN-V4FPMLZPR
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRAV36/DV7*04: a Homo sapiens TRA V allele sequence, 277 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| HUMAN-VYPJTOJZO | TRAV36/DV7*04 | 271 nt | contained in this record | 2013-01-20–2026-01-04 |
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | TRA / V |
| Functional i | True |
| Length | 277 nt |
| Protein UID i | HUMAN-VP-HJGEO2 (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: re-cut from TRAV36/DV7*04 (271 nt);
Allele names i
Every name below denotes this exact sequence (HUMAN-V4FPMLZPR). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRAV36/DV7*04 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AB504418.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link IMGT: TRAV36/DV7*04
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 22792299 | Unbiased analysis of TCRα/β chains at the single-cell level in human CD8+ T-cell subsets. | name mentioned* | literature_supp |
| 31237075 | Comparative analysis of CDR3 regions in paired human αβ CD8 T cells. | name mentioned* | literature_supp |
| 36408799 | SARS-CoV-2-specific CD4+ and CD8+ T cell responses can originate from cross-reactive CMV-specific T cells. | name mentioned* | literature_supp |
| 38871688 | Germline-like TCR-α chains shared between autoreactive T cells in blood and pancreas. | name mentioned* | literature_supp |
| 38954022 | Identification and validation of tumor-specific T cell receptors from tumor infiltrating lymphocytes using tumor organoid co-cultures. | name mentioned* | literature_supp |
| 39472557 | Physiological and pathogenic T cell autoreactivity converge in type 1 diabetes. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGCTCCCTAGTCACCTGCAGCCTGTACTCAAATT | IMGT | HUMAN-RJQEST |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGATGAAGTGTCCACAGGCTTTACTAGCTATCTTTTGGCTTCTACTGAGCTGGGTGAGCAGT | 52 + 11 nt | IMGT | HUMAN-LSAD4N |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-V4FPMLZPR/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases