HUMAN-VFASBVSR5
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV1-45*03: a Homo sapiens IGH V allele sequence, 296 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| HUMAN-VUSIPJ2KR | IGHV1-45*03 | 260 nt | contained in this record | 2013-01-20–2015-03-19 |
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 296 nt |
| Protein UID i | HUMAN-VP-52EWHM (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: re-cut from IGHV1-45*03 (260 nt);
Allele names i
Every name below denotes this exact sequence (HUMAN-VFASBVSR5). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-45*03 | IMGT | IMGT, KIARVA, OGRDB |
External records i
GenBank: GENBANK:IMGT000112 IMGT: IGHV1-45*03 OGRDB: IGHV1-45*03
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | sequence in paper | literature_supp |
| 38643233 | An ancestral SARS-CoV-2 vaccine induces anti-Omicron variants antibodies by hypermutation. | sequence in paper | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 32636395 | IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms. | name mentioned* | literature_supp |
| 34484220 | RAPID: A Rep-Seq Dataset Analysis Platform With an Integrated Antibody Database. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, KIARVA, OGRDB. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTGAAAACCCACATCCTGAGACCGTCAGAAACC | IMGT | HUMAN-RBBZOB |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGACTGGACCTGGAGAATCCTCTTCTTGGTGGCAGCAGCCACAGATGCCTACTCC | 46 + 11 nt | IMGT | HUMAN-LEQMKD |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VFASBVSR5/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases