HUMAN-VIYKXZXZX
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGH / V |
| Functional i | False |
| Length | 296 nt |
| Protein UID i | HUMAN-VP-WKZVIM (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (HUMAN-VIYKXZXZX). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1/OR15-1*03 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| HM855589.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:HM855589 IMGT: IGHV1/OR15-1*03
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | sequence in paper | literature_supp |
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTGAAAACCACATCCT | IMGT | HUMAN-RJZNAU |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VIYKXZXZX/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases