HUMAN-VOCZRGQHE
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV3-47*01: a Homo sapiens IGH V allele sequence, 293 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| HUMAN-VBMJO6KEN | IGHV3-47*01 | 291 nt | contained in this record | 2013-01-20–2023-02-20 |
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGH / V |
| Functional i | False |
| Length | 293 nt |
| Protein UID i | HUMAN-VP-RDBPDA (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: re-cut from IGHV3-47*01 (291 nt);
Allele names i
Every name below denotes this exact sequence (HUMAN-VOCZRGQHE). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-47*01 | IMGT | IMGT, OGRDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| BK063799.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:BK063799 GenBank: GENBANK:BK063799.1 IMGT: IGHV3-47*01 OGRDB: IGHV3-47*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 34875068 | verified | ncbi_nucleotide | |
| 31974198 | Genomic arrays identify high-risk chronic lymphocytic leukemia with genomic complexity: a multi-center study. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 34484220 | RAPID: A Rep-Seq Dataset Analysis Platform With an Integrated Antibody Database. | name mentioned* | literature_supp |
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | name mentioned* | literature_supp |
| 35545447 | Gene prediction in the immunoglobulin loci. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAAGTCAATGTGAGCCCAGATACAAACT | IMGT | HUMAN-RVMHTC |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| AGGGAGTTTGTGCTAAGCTGGGTTTTCCTTGTTGCTATATTAAAATGTGTCCAGTGT | 46 + 11 nt | IMGT | HUMAN-LGLBYZ |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VOCZRGQHE/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases