HUMAN-VUCKIRITU
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGLV2-14*03: a Homo sapiens IGL V allele sequence, 297 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| HUMAN-VTM544664 | IGLV2-14*03 | 274 nt | contained in this record | 2013-01-20–2020-01-31 |
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGL / V |
| Functional i | True |
| Length | 297 nt |
| Protein UID i | HUMAN-VP-QUDFMS (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: re-cut from IGLV2-14*03 (274 nt);
Allele names i
Every name below denotes this exact sequence (HUMAN-VUCKIRITU). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV2-14*03 | IMGT | IMGT, OGRDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AC279423.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:AC279423 GenBank: GENBANK:AC279423.1 IMGT: IGLV2-14*03 OGRDB: IGLV2-14*03
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 34587480 | Paired heavy- and light-chain signatures contribute to potent SARS-CoV-2 neutralization in public antibody responses. | name mentioned* | literature_supp |
| 35108220 | Ultrapotent neutralizing antibodies against SARS-CoV-2 with a high degree of mutation resistance. | name mentioned* | literature_supp |
| 35397794 | A large-scale systematic survey reveals recurring molecular features of public antibody responses to SARS-CoV-2. | name mentioned* | literature_supp |
| 35776090 | Antibody evolution to SARS-CoV-2 after single-dose Ad26.COV2.S vaccine in humans. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | name mentioned* | literature_supp |
| 38205245 | Comprehensive characterization and database construction of immune repertoire in the largest Chinese glioma cohort. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 39313500 | Large B-cell lymphomas with CCND1 rearrangement have different immunoglobulin gene breakpoints and genomic profile than mantle cell lymphoma. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 40710355 | Pathogenesis of Graves' Disease Determined Using Single-Cell Sequencing with Thyroid Autoantigen Peptide Stimulation in B Cells. | name mentioned* | literature_supp |
| 40789024 | Structural insights into VRC01-class bnAb precursors with diverse light chains elicited in the IAVI G001 human vaccine trial. | name mentioned* | literature_supp |
| 41634487 | Identification of a potent V3 glycan site broadly neutralizing antibody targeting an N332gp120 glycan-independent epitope. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
| 42256548 | Genomic heterogeneity in primary cutaneous follicular center lymphomas reveals different clinicopathological subgroups. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGGTCCAAGTTCCTGGGGAACTGAGACCAAAACC | IMGT | HUMAN-R7KL34 |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAGGGTCCTGGGCC | 46 + 11 nt | IMGT | HUMAN-LVOMOV |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VUCKIRITU/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases