HUMAN-VUWHTGUDJ
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGLV1-40*01: a Homo sapiens IGL V allele sequence, 299 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGL / V |
| Functional i | True |
| Length | 299 nt |
| Protein UID i | HUMAN-VP-WJGLY4 (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (HUMAN-VUWHTGUDJ). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV1-40*01 | IMGT | IMGT, OGRDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| D87010.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:D87010 GenBank: GENBANK:D87010.1 IMGT: IGLV1-40*01 OGRDB: IGLV1-40*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 9074928 | verified | ncbi_nucleotide | |
| 25338678 | Sequencing of the human IG light chain loci from a hydatidiform mole BAC library reveals locus-specific signatures of genetic diversity. | name mentioned* | literature_supp |
| 26608341 | Longitudinal analysis of the peripheral B cell repertoire reveals unique effects of immunization with a new influenza virus strain. | name mentioned* | literature_supp |
| 27423190 | A Single Human Papillomavirus Vaccine Dose Improves B Cell Memory in Previously Infected Subjects. | name mentioned* | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 30530648 | Virus-inclusive single-cell RNA sequencing reveals the molecular signature of progression to severe dengue. | name mentioned* | literature_supp |
| 30697215 | VH1-69 Utilizing Antibodies Are Capable of Mediating Non-neutralizing Fc-Mediated Effector Functions Against the Transmitted/Founder gp120. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 33180672 | Hiding in plain sight: structure and sequence analysis reveals the importance of the antibody DE loop for antibody-antigen binding. | name mentioned* | literature_supp |
| 33485405 | Enhancement versus neutralization by SARS-CoV-2 antibodies from a convalescent donor associates with distinct epitopes on the RBD. | name mentioned* | literature_supp |
| 33969321 | Divergent and self-reactive immune responses in the CNS of COVID-19 patients with neurological symptoms. | name mentioned* | literature_supp |
| 34104872 | Potent germline-like monoclonal antibodies: rapid identification of promising candidates for antibody-based antiviral therapy. | name mentioned* | literature_supp |
| 34126625 | Naturally enhanced neutralizing breadth against SARS-CoV-2 one year after infection. | name mentioned* | literature_supp |
| 34242577 | In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. | name mentioned* | literature_supp |
| 34587480 | Paired heavy- and light-chain signatures contribute to potent SARS-CoV-2 neutralization in public antibody responses. | name mentioned* | literature_supp |
| 34788600 | Immunizations with diverse sarbecovirus receptor-binding domains elicit SARS-CoV-2 neutralizing antibodies against a conserved site of vulnerability. | name mentioned* | literature_supp |
| 35108220 | Ultrapotent neutralizing antibodies against SARS-CoV-2 with a high degree of mutation resistance. | name mentioned* | literature_supp |
| 35397794 | A large-scale systematic survey reveals recurring molecular features of public antibody responses to SARS-CoV-2. | name mentioned* | literature_supp |
| 35447092 | Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. | name mentioned* | literature_supp |
| 35776090 | Antibody evolution to SARS-CoV-2 after single-dose Ad26.COV2.S vaccine in humans. | name mentioned* | literature_supp |
| 36006380 | Humoral immunity to SARS-CoV-2 elicited by combination COVID-19 vaccination regimens. | name mentioned* | literature_supp |
| 36149398 | Memory B cell responses to Omicron subvariants after SARS-CoV-2 mRNA breakthrough infection in humans. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | name mentioned* | literature_supp |
| 37368240 | Memory B cell development elicited by mRNA booster vaccinations in the elderly. | name mentioned* | literature_supp |
| 38205245 | Comprehensive characterization and database construction of immune repertoire in the largest Chinese glioma cohort. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 38643233 | An ancestral SARS-CoV-2 vaccine induces anti-Omicron variants antibodies by hypermutation. | name mentioned* | literature_supp |
| 38671086 | Hyper-N-glycosylated SEL1L3 as auto-antigenic B-cell receptor target of primary vitreoretinal lymphomas. | name mentioned* | literature_supp |
| 39313500 | Large B-cell lymphomas with CCND1 rearrangement have different immunoglobulin gene breakpoints and genomic profile than mantle cell lymphoma. | name mentioned* | literature_supp |
| 40211048 | Single-cell profiling of peripheral blood mononuclear cells from patients treated with oncolytic adenovirus TILT-123 reveals baseline immune status as a predictor of therapy outcomes. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 40789024 | Structural insights into VRC01-class bnAb precursors with diverse light chains elicited in the IAVI G001 human vaccine trial. | name mentioned* | literature_supp |
| 41606257 | Allergen-specific human IgE isolated through an allergen-agnostic pipeline-understanding immune response and allergen recognition. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGCTCCAGGCCCGGGGGGAACTGAGACAAGAACC | IMGT | HUMAN-RNO2CP |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGCCTGGTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGGTCCTGGGCC | 46 + 11 nt | IMGT | HUMAN-LFXPYH |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VUWHTGUDJ/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases