HUMAN-VYEQH7CWB
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGLV3-21*04: a Homo sapiens IGL V allele sequence, 290 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Homo sapiens (NCBITAXON:9606) |
|---|---|
| Locus / type | IGL / V |
| Functional i | True |
| Length | 290 nt |
| Protein UID i | HUMAN-VP-XWCC3N (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (HUMAN-VYEQH7CWB). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV3-21*04 | IMGT | IMGT, OGRDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AC279208.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:AC279208 GenBank: GENBANK:AC279208.1 IMGT: IGLV3-21*04 OGRDB: IGLV3-21*04
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 34513715 | Consistent B Cell Receptor Immunoglobulin Features Between Siblings in Familial Chronic Lymphocytic Leukemia. | name mentioned* | literature_supp |
| 34993136 | The Determinants of B Cell Receptor Signaling as Prototype Molecular Biomarkers of Leukemia. | name mentioned* | literature_supp |
| 35294518 | Prevalence of IGLV3-21R110 among familial CLL: a retrospective study of 45 cases. | name mentioned* | literature_supp |
| 35397794 | A large-scale systematic survey reveals recurring molecular features of public antibody responses to SARS-CoV-2. | name mentioned* | literature_supp |
| 35804817 | Immunoglobulin Gene Sequence as an Inherited and Acquired Risk Factor for Chronic Lymphocytic Leukemia. | name mentioned* | literature_supp |
| 36574772 | Immunoglobulin germline gene polymorphisms influence the function of SARS-CoV-2 neutralizing antibodies. | name mentioned* | literature_supp |
| 37076511 | Vaccination of SARS-CoV-2-infected individuals expands a broad range of clonally diverse affinity-matured B cell lineages. | name mentioned* | literature_supp |
| 37505099 | IGLV3-21R110 mutation has prognostic value in patients with treatment-naive chronic lymphocytic leukemia. | name mentioned* | literature_supp |
| 37533642 | TRAPnSeq allows high-throughput profiling of antigen-specific antibody-secreting cells. | name mentioned* | literature_supp |
| 37746159 | All-CLL: A Capture-based Next-generation Sequencing Panel for the Molecular Characterization of Chronic Lymphocytic Leukemia. | name mentioned* | literature_supp |
| 39732734 | Insights into genetic aberrations and signalling pathway interactions in chronic lymphocytic leukemia: from pathogenesis to treatment strategies. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
| 42306064 | IGLV3-21R110 and ibrutinib treatment: Results from the double-blind, randomized, placebo-controlled GCLLSG CLL12 trial in early-stage CLL. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACGGTGACACAGGCAGATGAGGAAGTGAGACAAAAACA | IMGT | HUMAN-R3E4WV |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGCTCTGTGACC | 46 + 11 nt | IMGT | HUMAN-L6BY3O |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/HUMAN-VYEQH7CWB/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases