MOUSE-V7NM55AQK
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRAV15D-1/DV6D-1*07, TRAV15N-1*01: a Mus musculus TRA V allele sequence, 292 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | TRA / V |
| Functional i | True |
| Length | 292 nt |
| Protein UID i | MOUSE-VP-W7PIFH (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (MOUSE-V7NM55AQK). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: TRAV15D-1/DV6D-1*07, TRAV15N-1*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| TRAV15D-1/DV6D-1*07 | IMGT | IMGT |
| TRAV15N-1*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| NZ_CM188256.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link IMGT: TRAV15D-1/DV6D-1*07
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTTTGAAGTGACAGCACAAGCTGAACAAAAACT | IMGT | MOUSE-RLBO6L |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGCCTCCTCACAGCCTGTTCTGTGTGCTGGTGGCCTTGGCTTTCTCTGGATCTAATGTG | 49 + 11 nt | IMGT | MOUSE-L4NMHV |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-V7NM55AQK/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases