MOUSE-VIWCEFJ7A
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 252 nt |
| Protein UID i | MOUSE-VP-PEGVRJ (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (MOUSE-VIWCEFJ7A). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-55*02 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| L26877.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:L26877 GenBank: GENBANK:L26877.1 IMGT: IGHV1-55*02
Literature references i
PubMed publications linked to this allele.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 7991601 | verified | ncbi_nucleotide |
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGGATGGAGCTGTATCATCCTCTTTTTGGTAGCAGCAGCTACAGGTGTCCACTCC | 46 + 11 nt | IMGT | MOUSE-LTKTWR |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-VIWCEFJ7A/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases