MOUSE-VJ77PH4LK
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV4-2*01: a Mus musculus IGH V allele sequence, 296 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | IGH / V |
| Functional i | False |
| Length | 296 nt |
| Protein UID i | MOUSE-VP-T5IGPS (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (MOUSE-VJ77PH4LK). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV4-2*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AC073563.3 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:AC073563 GenBank: GENBANK:AC073563.3 IMGT: IGHV4-2*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 35720344 | A BALB/c IGHV Reference Set, Defined by Haplotype Analysis of Long-Read VDJ-C Sequences From F1 (BALB/c x C57BL/6) Mice. | name mentioned* | literature_supp |
| 38961347 | Systematic characterization of immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic cod (Gadus morhua). | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGAAATCTCAGTTTTTACCCAGACATGAACC | IMGT | MOUSE-RHFH4N |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGATTTTGGGCTGATTTTTTTTATTGTTGCTCTTTTAAAAGGGGTCCAGTGT | 43 + 11 nt | IMGT | MOUSE-LFKZJW |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-VJ77PH4LK/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases