MOUSE-VLX3B56QR

AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.

SpeciesMus musculus LocusIGH TypeV FunctionalNone Length277 nt

IGHV5-8*01: a Mus musculus IGH V allele sequence, 277 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.

Earlier records of this allele i

IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.

Record	Name	Length	Relation to this record	IMGT releases
MOUSE-VTMAALBJA	*IGHV5-801**	279 nt	contains this record	2013-01-20

Species	Mus musculus (NCBITAXON:10090)
Locus / type	IGH / V
Functional i	None
Length	277 nt
Protein UID i	MOUSE-VP-Q2R2GD (shared by alleles with the same V-REGION amino-acid sequence)

Coding sequence (nt)

277 nt

GAGGTGAAGCTGGTGGAGTCTGTGGGAGGCTTAGTGCAGCCTGGAGGGTCGCTGAAACTCTCCTGGGCAGCCTCTGGATTAACTCACTGACAACTGAATGACCTGGGTCCTTCAGGCTCCAAGGAAGGGGCTGGAGAGGGTGGCAATAATTTTTAGTGGTGGAGGTAGCACCTACTATATAGACGCAATGAAGGGCCGATTCACCGTCTCCAGAGATGATAACAAAAACACACTTTACCTGAAAATAAACAGTCTGAGGTCTGAGTACACAGCCATG

Amino-acid sequence (V-REGION)

92 aa

EVKLVESVGGLVQPGGSLKLSWAASGLTH*QLNDLGPSGSKEGAGEGGNNF*WWR*HLLYRRNEGPIHRLQR**QKHTLPENKQSEV*VHSH

Translated here from the nucleotide sequence; no source published a protein for this allele. i

Name history i: re-cut from IGHV5-8*01 (279 nt);

Allele names i

Every name below denotes this exact sequence (MOUSE-VLX3B56QR). None is canonical; they are labels, and the UID is the key.

Name	Scheme	Source(s)
IGHV5-8*01	IMGT	IMGT

External records i

IMGT: IGHV5-8*01

Contributed by IMGT. See Sources & citations for each source's version, citation and licence.

Leader

Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.

Leader (exon 1 + exon 2)	Split	Source	Leader UID
ATGGACTTTGAGCTCAGCTTTGTTTTCCTTGTTCTGATTTTAAAAGGTGCCCAGTGT	46 + 11 nt	IMGT	MOUSE-LLIMY3

Find similar (nt · aa · cross-species) i

Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.

Ranks coding alleles by normalized edit-distance identity. Also available at /api/sequences/MOUSE-VLX3B56QR/similar?min_identity=0.95&kind=nt.

API: JSON · AIRR AlleleDescription · aliases