MOUSE-VPYQKA7H4
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV1-1*01: a Mus musculus IGH V allele sequence, 294 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| MOUSE-VJEXUB4AJ | IGHV1-1*01 | 291 nt | contained in this record | 2013-01-20–2015-03-19 |
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 294 nt |
| Protein UID i | MOUSE-VP-GT2TUJ (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: re-cut from IGHV1-1*01 (291 nt);
Allele names i
Every name below denotes this exact sequence (MOUSE-VPYQKA7H4). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-1*01 | IMGT | IMGT |
External records i
IMGT: IGHV1-1*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 27867380 | IMPre: An Accurate and Efficient Software for Prediction of T- and B-Cell Receptor Germline Genes and Alleles from Rearranged Repertoire Data. | name mentioned* | literature_supp |
| 29545792 | Coupling of Single Molecule, Long Read Sequencing with IMGT/HighV-QUEST Analysis Expedites Identification of SIV gp140-Specific Antibodies from scFv Phage Display Libraries. | name mentioned* | literature_supp |
| 36569888 | Chickens, more than humans, focus the diversity of their immunoglobulin genes on the complementarity-determining region but utilise amino acids, indicative of a more cross-reactive antibody repertoire. | name mentioned* | literature_supp |
| 36604758 | Bacteroides-derived isovaleric acid enhances mucosal immunity by facilitating intestinal IgA response in broilers. | name mentioned* | literature_supp |
| 38567069 | Diversification of immunoglobulin genes by gene conversion in the domestic chicken (Gallus gallus domesticus). | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | TATTTATTGTATGTCACATCCTCACTGTGACGTAAATC | IMGT | MOUSE-RMD27Q |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-VPYQKA7H4/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases