MOUSE-VU4J7DUZA
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 294 nt |
| Protein UID i | MOUSE-VP-ZUGVM7 (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (MOUSE-VU4J7DUZA). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV1-52*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AC074329.2 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:AC074329 IMGT: IGHV1-52*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 35720344 | A BALB/c IGHV Reference Set, Defined by Haplotype Analysis of Long-Read VDJ-C Sequences From F1 (BALB/c x C57BL/6) Mice. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 40338637 | Comprehensive analysis of nasal IgA antibodies induced by intranasal administration of the SARS-CoV-2 spike protein. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTTGTAACCACATCCTGAGAGTGTCAGAAACC | IMGT | MOUSE-R2WMJY |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGTGTCCACTCC | 46 + 11 nt | IMGT | MOUSE-LG6JKD |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-VU4J7DUZA/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases