MOUSE-VY7YP7MDG
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRAV5-3*01: a Mus musculus TRA V allele sequence, 269 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
Earlier records of this allele i
IMGT has published this allele name over more than one sequence extent. Earlier sequence extents are deferred from default search results but remain resolvable, so a paper that cited one still leads here.
| Record | Name | Length | Relation to this record | IMGT releases |
|---|---|---|---|---|
| MOUSE-V6M2IMI5K | TRAV5-3*01 | 280 nt | contains this record | 2013-01-20–2025-01-05 |
| Species | Mus musculus (NCBITAXON:10090) |
|---|---|
| Locus / type | TRA / V |
| Functional i | None |
| Length | 269 nt |
| Protein UID i | MOUSE-VP-7SRJ4L (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: re-cut from TRAV5-3*01 (280 nt);
Allele names i
Every name below denotes this exact sequence (MOUSE-VY7YP7MDG). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRAV5-3*01 | IMGT | IMGT |
External records i
IMGT: TRAV5-3*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACCCTGCTCCACAGGGACCTGCAGTCCATCTGTCCTCA | IMGT | MOUSE-RLX7SX |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/MOUSE-VY7YP7MDG/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases