ORANGSUM-V5KPJDRNM
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRBV26*01: a Pongo abelii TRB V allele sequence, 287 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Pongo abelii (NCBITAXON:9601) |
|---|---|
| Locus / type | TRB / V |
| Functional i | None |
| Length | 287 nt |
| Protein UID i | ORANGSUM-VP-DFRMDF (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (ORANGSUM-V5KPJDRNM). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRBV26*01 | IMGT | IMGT |
External records i
IMGT: TRBV26*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 27460926 | Single-cell TCRseq: paired recovery of entire T-cell alpha and beta chain transcripts in T-cell receptors from single-cell RNAseq. | name mentioned* | literature_supp |
| 28561797 | TRAV7-2*02 Expressing CD8⁺ T Cells Are Responsible for Palladium Allergy. | name mentioned* | literature_supp |
| 35436998 | pmTR database: population matched (pm) germline allelic variants of T-cell receptor (TR) loci. | name mentioned* | literature_supp |
| 36408799 | SARS-CoV-2-specific CD4+ and CD8+ T cell responses can originate from cross-reactive CMV-specific T cells. | name mentioned* | literature_supp |
| 38336680 | NY-ESO-1-specific T cell receptor-engineered T cells and Tranilast, a TRPV2 antagonist bivalent treatment enhances the killing of esophageal cancer: a dual-targeted cancer therapeutic route. | name mentioned* | literature_supp |
| 38352870 | Single-cell RNA sequencing reveals the dynamics and heterogeneity of lymph node immune cells during acute and chronic viral infections. | name mentioned* | literature_supp |
| 38762584 | Invariant γδTCR natural killer-like effector T cells in the naked mole-rat. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CATAGCACTGCATAGCCACATCCTCTCCACACACAAAAA | IMGT | ORANGSUM-RBKXLH |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/ORANGSUM-V5KPJDRNM/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases