ORANGSUM-VFZVM247D
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV3-66*02: a Pongo abelii IGH V allele sequence, 293 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Pongo abelii (NCBITAXON:9601) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 293 nt |
| Protein UID i | ORANGSUM-VP-YKTI53 (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (ORANGSUM-VFZVM247D). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-66*02 | IMGT | IMGT |
External records i
IMGT: IGHV3-66*02
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 22111995 | Isolation of a nanomolar scFv inhibiting the endopeptidase activity of botulinum toxin A, by single-round panning of an immune phage-displayed library of macaque origin. | name mentioned* | literature_supp |
| 22216179 | Biased use of the IGHV4 family and evidence for antigen selection in Chlamydophila psittaci-negative ocular adnexal extranodal marginal zone lymphomas. | name mentioned* | literature_supp |
| 22806814 | Degenerate primer design to clone the human repertoire of immunoglobulin heavy chain variable regions. | name mentioned* | literature_supp |
| 25330199 | Characteristics of memory B cells elicited by a highly efficacious HPV vaccine in subjects with no pre-existing immunity. | name mentioned* | literature_supp |
| 26440796 | Development of Human-Like scFv-Fc Neutralizing Botulinum Neurotoxin E. | name mentioned* | literature_supp |
| 30697215 | VH1-69 Utilizing Antibodies Are Capable of Mediating Non-neutralizing Fc-Mediated Effector Functions Against the Transmitted/Founder gp120. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 32878258 | Immunoglobulins or Antibodies: IMGT® Bridging Genes, Structures and Functions. | name mentioned* | literature_supp |
| 33661303 | Plasmodium falciparum-specific IgM B cells dominate in children, expand with malaria, and produce functional IgM. | name mentioned* | literature_supp |
| 33843586 | Distinct clonal evolution of B-cells in HIV controllers with neutralizing antibody breadth. | name mentioned* | literature_supp |
| 34126625 | Naturally enhanced neutralizing breadth against SARS-CoV-2 one year after infection. | name mentioned* | literature_supp |
| 34242577 | In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. | name mentioned* | literature_supp |
| 34587480 | Paired heavy- and light-chain signatures contribute to potent SARS-CoV-2 neutralization in public antibody responses. | name mentioned* | literature_supp |
| 34614412 | mRNA vaccination of naive and COVID-19-recovered individuals elicits potent memory B cells that recognize SARS-CoV-2 variants. | name mentioned* | literature_supp |
| 34785098 | Landscapes and dynamic diversifications of B-cell receptor repertoires in COVID-19 patients. | name mentioned* | literature_supp |
| 34788600 | Immunizations with diverse sarbecovirus receptor-binding domains elicit SARS-CoV-2 neutralizing antibodies against a conserved site of vulnerability. | name mentioned* | literature_supp |
| 34806017 | CRIS: complete reconstruction of immunoglobulin V-D-J sequences from RNA-seq data. | name mentioned* | literature_supp |
| 35447092 | Analysis of memory B cells identifies conserved neutralizing epitopes on the N-terminal domain of variant SARS-Cov-2 spike proteins. | name mentioned* | literature_supp |
| 35545447 | Gene prediction in the immunoglobulin loci. | name mentioned* | literature_supp |
| 35837088 | Characterizing Features of Human Circulating B Cells Carrying CLL-Like Stereotyped Immunoglobulin Rearrangements. | name mentioned* | literature_supp |
| 36006380 | Humoral immunity to SARS-CoV-2 elicited by combination COVID-19 vaccination regimens. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 36574772 | Immunoglobulin germline gene polymorphisms influence the function of SARS-CoV-2 neutralizing antibodies. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 37368240 | Memory B cell development elicited by mRNA booster vaccinations in the elderly. | name mentioned* | literature_supp |
| 40066131 | Characterization of Immunoglobulin Heavy Locus Rearrangements in Molecular Subtypes of Childhood B-Cell Precursor Acute Lymphoblastic Leukemia. | name mentioned* | literature_supp |
| 41606257 | Allergen-specific human IgE isolated through an allergen-agnostic pipeline-understanding immune response and allergen recognition. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAAGGGAAGTCACTGTGTGCCCAAACACAAACC | IMGT | ORANGSUM-RODXUG |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGCAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGCTGTTTTAAAAGGTGTCCAGTGT | 46 + 11 nt | IMGT | ORANGSUM-LD4BJU |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/ORANGSUM-VFZVM247D/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases