ORANGSUM-VYMT44YXY
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV3-21*02: a Pongo abelii IGH V allele sequence, 302 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Pongo abelii (NCBITAXON:9601) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 302 nt |
| Protein UID i | ORANGSUM-VP-G3DAOI (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (ORANGSUM-VYMT44YXY). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-21*02 | IMGT | IMGT |
External records i
IMGT: IGHV3-21*02
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 25330199 | Characteristics of memory B cells elicited by a highly efficacious HPV vaccine in subjects with no pre-existing immunity. | name mentioned* | literature_supp |
| 25799103 | VDJSeq-Solver: in silico V(D)J recombination detection tool. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 32636395 | IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms. | name mentioned* | literature_supp |
| 32668194 | Next-Generation Sequencing of T and B Cell Receptor Repertoires from COVID-19 Patients Showed Signatures Associated with Severity of Disease. | name mentioned* | literature_supp |
| 33485405 | Enhancement versus neutralization by SARS-CoV-2 antibodies from a convalescent donor associates with distinct epitopes on the RBD. | name mentioned* | literature_supp |
| 33843586 | Distinct clonal evolution of B-cells in HIV controllers with neutralizing antibody breadth. | name mentioned* | literature_supp |
| 34785098 | Landscapes and dynamic diversifications of B-cell receptor repertoires in COVID-19 patients. | name mentioned* | literature_supp |
| 35837088 | Characterizing Features of Human Circulating B Cells Carrying CLL-Like Stereotyped Immunoglobulin Rearrangements. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36351924 | Single-cell profiling reveals a memory B cell-like subtype of follicular lymphoma with increased transformation risk. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 37533642 | TRAPnSeq allows high-throughput profiling of antigen-specific antibody-secreting cells. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 40588565 | Disease-specific U1 spliceosomal RNA mutations in mature B-cell neoplasms. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
| 42306064 | IGLV3-21R110 and ibrutinib treatment: Results from the double-blind, randomized, placebo-controlled GCLLSG CLL12 trial in early-stage CLL. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAGTGAGTGTGAGCTCAGACACAAATT | IMGT | ORANGSUM-RJWB6X |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGAGTTTGGGCTGAGCTGGGTTTTCCTTTTTGCTATTTTCAAAGGTGTCCAGTGT | 46 + 11 nt | IMGT | ORANGSUM-LGEEY4 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/ORANGSUM-VYMT44YXY/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases