PIG-D7ZARA23E
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
TRBD1*01: a Sus scrofa TRB D allele sequence, 14 nt, functional. The nucleotide sequence is below, with every recorded name and its source.
| Species | Sus scrofa (NCBITAXON:9823) |
|---|---|
| Locus / type | TRB / D |
| Functional i | True |
| Length | 14 nt |
Coding sequence (nt)
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (PIG-D7ZARA23E). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| TRBD1*01 | IMGT | IMGT |
External records i
IMGT: TRBD1*01
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| d_rs_3 | CACGGTGATTCAACCCTACGGAGAATCTTTACAAAAACC | IMGT | PIG-RT5JEV |
| d_rs_5 | CGTTTTTGTATAAAGCTGTAATGCTGTG | IMGT | PIG-RLAHET |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Restricted for D genes: only 14 nt alleles are compared, position by position. D genes are too short (8–148 nt, median 19 nt) for edit-distance scores to be interpreted reliably; the metric can open gaps that inflate identity, and at 19 nt the 0.75 identity floor is about four mismatches. A D allele is therefore compared only against D alleles of exactly the same length, scored position by position. Alleles of the same gene that differ in length are not ranked here; separating those requires a multiple-sequence alignment, not a pairwise score.
Ranks D alleles of the same length,
by positional identity.
Also available at /api/sequences/PIG-D7ZARA23E/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases