RAT-VBNYR5IQN
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV2-70*01: a Rattus norvegicus IGH V allele sequence, 293 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Rattus norvegicus (NCBITAXON:10116) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 293 nt |
| Protein UID i | RAT-VP-JZBKYR (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RAT-VBNYR5IQN). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV2-70*01 | IMGT | IMGT |
External records i
IMGT: IGHV2-70*01
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 31974198 | Genomic arrays identify high-risk chronic lymphocytic leukemia with genomic complexity: a multi-center study. | name mentioned* | literature_supp |
| 33843586 | Distinct clonal evolution of B-cells in HIV controllers with neutralizing antibody breadth. | name mentioned* | literature_supp |
| 34242577 | In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. | name mentioned* | literature_supp |
| 34667305 | Commentary on Population matched (pm) germline allelic variants of immunoglobulin (IG) loci: relevance in infectious diseases and vaccination studies in human populations. | name mentioned* | literature_supp |
| 34785098 | Landscapes and dynamic diversifications of B-cell receptor repertoires in COVID-19 patients. | name mentioned* | literature_supp |
| 34806017 | CRIS: complete reconstruction of immunoglobulin V-D-J sequences from RNA-seq data. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36555330 | Single-Cell RNA Sequencing for the Detection of Clonotypic V(D)J Rearrangements in Multiple Myeloma. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 39840032 | An allelic atlas of immunoglobulin heavy chain variable regions reveals antibody binding epitope preference resilient to SARS-CoV-2 mutation escape. | name mentioned* | literature_supp |
| 39873992 | Association of Specific Gene Mutations with Immunoglobulin Heavy-Chain Variable Region and Chromosomal Alterations in Chronic Lymphocytic Leukemia Patients in India. | name mentioned* | literature_supp |
| 40066131 | Characterization of Immunoglobulin Heavy Locus Rearrangements in Molecular Subtypes of Childhood B-Cell Precursor Acute Lymphoblastic Leukemia. | name mentioned* | literature_supp |
| 40588565 | Disease-specific U1 spliceosomal RNA mutations in mature B-cell neoplasms. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 41606257 | Allergen-specific human IgE isolated through an allergen-agnostic pipeline-understanding immune response and allergen recognition. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 41803327 | IFN-gene signatures in B cells following influenza A and B virus infection and influenza vaccination. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGAGGAGTTCAGTATGAACTTTCACAAAAAAT | IMGT | RAT-R6LKSE |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGCTATCTTGGTGCTGTTGCTCTGCCTGGTGACATTTCCAAGCTGTGCTCTGTCC | 46 + 11 nt | IMGT | RAT-LKUN4A |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RAT-VBNYR5IQN/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases