RHESUS-D22CYMNKP
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / D |
| Functional i | True |
| Length | 17 nt |
Allele names i
Every name below denotes this exact sequence (RHESUS-D22CYMNKP). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 3 different allele designations: IGHD1-20*02, IGHD1-4*01, IGHD1-19*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHD1-2J4B*03 | IgLabel | OGRDB |
| IGHD1-GRMY*01 | IgLabel | MUSA |
| IGHD1-20*02 | IMGT | IMGT |
| IGHD1-4*01 | KIMDB | KIMDB |
| IGHD1-19*01 | RhGLDB+ | RhGLDB+ |
External records i
genbank:MF989451: GENBANK:MF989451 GenBank: GENBANK:SBKD01000511 IMGT: IGHD1-20*02 OGRDB: IGHD1-2J4B*03
Literature references i
PubMed publications linked to this allele.
Contributed by IMGT, KIMDB, MUSA, OGRDB, RhGLDB+. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| d_rs_3 | CACTGTGAGAAAAGCTGTGTCCAAAACT | IMGT MUSA | RHESUS-RIGFJX |
| d_rs_5 | GGATTCTGAACAGCCCCGAGTCACAGTG | IMGT MUSA | RHESUS-RYPIRW |
Find similar alleles
Restricted for D genes: only 17 nt alleles are compared, position by position. D genes are too short (8–148 nt, median 19 nt) for edit-distance scores to be interpreted reliably; the metric can open gaps that inflate identity, and at 19 nt the 0.75 identity floor is about four mismatches. A D allele is therefore compared only against D alleles of exactly the same length, scored position by position. Alleles of the same gene that differ in length are not ranked here; separating those requires a multiple-sequence alignment, not a pairwise score.
Ranks D alleles of the same length,
by positional identity.
Also available at /api/sequences/RHESUS-D22CYMNKP/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
API: JSON · AIRR AlleleDescription · aliases