RHESUS-DMTOFRSZM
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHD6-64ZP*03_i0c_g1a_g3a_t4c_a5g_a7g_g8c_c12g_c15g_18gtgattgtgc27: a Macaca mulatta IGH D allele sequence, 28 nt, non-functional. The nucleotide sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / D |
| Functional i | False |
| Length | 28 nt |
Coding sequence (nt)
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-DMTOFRSZM). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHD6-64ZP*03_i0c_g1a_g3a_t4c_a5g_a7g_g8c_c12g_c15g_18gtgattgtgc27 | VDJbase | MUSA |
Contributed by MUSA. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| d_rs_3 | CCAAATGGTGTTGTGGCCATCTACTACC | MUSA | RHESUS-RDEMDD |
| d_rs_5 | GGTTAGTGCTATTAACTCAGCCTTCTGTG | MUSA | RHESUS-RBLDNU |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Restricted for D genes: only 28 nt alleles are compared, position by position. D genes are too short (8–148 nt, median 19 nt) for edit-distance scores to be interpreted reliably; the metric can open gaps that inflate identity, and at 19 nt the 0.75 identity floor is about four mismatches. A D allele is therefore compared only against D alleles of exactly the same length, scored position by position. Alleles of the same gene that differ in length are not ranked here; separating those requires a multiple-sequence alignment, not a pairwise score.
Ranks D alleles of the same length,
by positional identity.
Also available at /api/sequences/RHESUS-DMTOFRSZM/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases