RHESUS-J3NRQX4C4
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / J |
| Functional i | True |
| Length | 54 nt |
Allele names i
Every name below denotes this exact sequence (RHESUS-J3NRQX4C4). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGHJ6*01, IGHJ6-6*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHJ6-GAIV*01 | IgLabel | MUSA, OGRDB |
| IGHJ6*01 | IMGT | IMGT |
| IGHJ6-6*01 | KIMDB | KIMDB |
| IGHJ6*01 | RhGLDB+ | RhGLDB+ |
External records i
genbank:MG879611: GENBANK:MG879611 GenBank: GENBANK:BK063715 IMGT: IGHJ6*01 OGRDB: IGHJ6-GAIV*01
Literature references i
PubMed publications linked to this allele.
Contributed by IMGT, KIMDB, MUSA, OGRDB, RhGLDB+. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| j_rs | GGTTTTTGTGGGGTGAGGATGGACATTCTGCCATTGTG | IMGT MUSA | RHESUS-RQHOHM |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-J3NRQX4C4/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
API: JSON · AIRR AlleleDescription · aliases