RHESUS-JJKHEJNJ4
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGLJ7-3R4H*02_t1g_g2c_c10t_a13c_c19g_a23c_t26c_g28c_c34t_c35t_c37a: a Macaca mulatta IGL J allele sequence, 38 nt, non-functional. The nucleotide sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / J |
| Functional i | False |
| Length | 38 nt |
Coding sequence (nt)
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-JJKHEJNJ4). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLJ0-YXJH*01 | IgLabel | OGRDB |
| IGLJ7-3R4H*02_t1g_g2c_c10t_a13c_c19g_a23c_t26c_g28c_c34t_c35t_c37a | VDJbase | MUSA |
External records i
OGRDB: IGLJ0-YXJH*01
Contributed by MUSA, OGRDB. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| j_rs | GGTTTCAATCCAAGCATAATTCACCGAG | MUSA | RHESUS-RNZB4J |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-JJKHEJNJ4/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases