RHESUS-JXYML4UN4
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / J |
| Functional i | True |
| Length | 52 nt |
Allele names i
Every name below denotes this exact sequence (RHESUS-JXYML4UN4). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHJ1-PVVP*01 | IgLabel | MUSA, OGRDB |
| IGHJ1*02 | IMGT | IMGT |
| IGHJ1*02 | RhGLDB+ | RhGLDB+ |
External records i
genbank:MF989493: GENBANK:MF989493 GenBank: GENBANK:BK063715 IMGT: IGHJ1*02 OGRDB: IGHJ1-PVVP*01
Literature references i
PubMed publications linked to this allele.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29163486 | verified | MUSA |
Contributed by IMGT, MUSA, OGRDB, RhGLDB+. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| j_rs | GGTTTCTGCAGCCCCTGGCTCAGGGCTGACTCACTGTG | IMGT MUSA | RHESUS-RU6SJ7 |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-JXYML4UN4/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
API: JSON · AIRR AlleleDescription · aliases