RHESUS-V2ZIO5QNI
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV3-12*01: a Macaca mulatta IGK V allele sequence, 290 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 290 nt |
| Protein UID i | RHESUS-VP-JTSBYB (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-V2ZIO5QNI). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV8-EXAK*01 | IgLabel | MUSA |
| IGKV8-IRUA*03 | IgLabel | OGRDB |
| IGKV3-12*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| BK063716.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:BK063716 GenBank: GENBANK:BK063716.1 IMGT: IGKV3-12*01 OGRDB: IGKV8-IRUA*03
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 34875068 | verified | ncbi_nucleotide | |
| 35335026 | verified | ncbi_nucleotide | |
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 38707998 | Maintenance of caecal homeostasis by diverse adaptive immune cells in the rhesus macaque. | sequence in paper | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 37533642 | TRAPnSeq allows high-throughput profiling of antigen-specific antibody-secreting cells. | name mentioned* | literature_supp |
| 37938344 | Role of affinity in plasma cell development in the germinal center light zone. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, MUSA, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTTAGAGACTGGAACAAAAACC | IMGT MUSA | RHESUS-RPOIUW |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-V2ZIO5QNI/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases