RHESUS-V3BDV2TWD
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | False |
| Length | 294 nt |
| Protein UID i | RHESUS-VP-2M26Q3 (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-V3BDV2TWD). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGLV7-55*01, IGLV7-ADJ*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV14-WNKU*01 | IgLabel | MUSA, OGRDB |
| IGLV7-55*01 | IMGT | IMGT |
| IGLV7-ADJ*01 | RhGLDB+ | RhGLDB+ |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| BK063717.1 | NCBI accession | ncbi_nucleotide |
External records i
genbank:MF989453: GENBANK:MF989453 genbank:IMGT000062: GENBANK:IMGT000062 NCBI nucleotide: link GenBank: GENBANK:BK063717 GenBank: GENBANK:BK063717.1 IMGT: IGLV7-55*01 OGRDB: IGLV14-WNKU*01
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence.
Contributed by IMGT, MUSA, OGRDB, RhGLDB+, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGACAGAGCTCAATAGGGAAAAGTGACACAAACT | IMGT MUSA | RHESUS-RQBDIX |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-V3BDV2TWD/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases