RHESUS-V4WJNOUNX
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | True |
| Length | 290 nt |
| Protein UID i | RHESUS-VP-ZYDZXC (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-V4WJNOUNX). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV3-2EX4*04 | IgLabel | MUSA |
| IGLV3S9*01 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AM055996.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:AM055996 GenBank: GENBANK:AM055996.1 IMGT: IGLV3S9*01
Literature references i
PubMed publications linked to this allele.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 16189671 | verified | ncbi_nucleotide |
Contributed by IMGT, MUSA, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATCCTCCTCACTCTCTGCACAGGTTCCGTGGTT | 22 + 11 nt | IMGT | RHESUS-LYSS2Q |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-V4WJNOUNX/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases