RHESUS-V63ZCXNDR
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | True |
| Length | 296 nt |
| Protein UID i | RHESUS-VP-NQKU4E (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-V63ZCXNDR). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGLV1-81*01, IGLV1-ADA*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV1-5WTR*02 | IgLabel | MUSA |
| IGLV1-6UWF*01 | IgLabel | OGRDB |
| IGLV1-81*01 | IMGT | IMGT |
| IGLV1-ADA*01 | RhGLDB+ | RhGLDB+ |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| BK063717.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGLV1-8*01 | 2019-03-01 |
External records i
genbank:MF989471: GENBANK:MF989471 genbank:IMGT000062: GENBANK:IMGT000062 NCBI nucleotide: link GenBank: GENBANK:BK063717 GenBank: GENBANK:BK063717.1 IMGT: IGLV1-81*01 OGRDB: IGLV1-6UWF*01
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 25319530 | verified | MUSA | |
| 27525066 | verified | MUSA | |
| 29163486 | verified | MUSA | |
| 31080066 | verified | MUSA | |
| 34875068 | verified | ncbi_nucleotide | |
| 35335026 | verified | ncbi_nucleotide | |
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 38707998 | Maintenance of caecal homeostasis by diverse adaptive immune cells in the rhesus macaque. | sequence in paper | literature_supp |
| 28813462 | A comprehensive profiling of T- and B-lymphocyte receptor repertoires from a Chinese-origin rhesus macaque by high-throughput sequencing. | name mentioned* | literature_supp |
| 38042809 | Interaction dynamics between innate and adaptive immune cells responding to SARS-CoV-2 vaccination in non-human primates. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, MUSA, OGRDB, RhGLDB+, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGCTCCAGGCCCAGGGGGAAGTGAGACAAGAACC | IMGT MUSA | RHESUS-RJJJ4Z |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGCCTGGTTCCCTCTCGTCCTCACCCTCCTCACTCACTGTGCAGGTGGTCCTGGGCC | 48 + 11 nt | MUSA | RHESUS-L3X5K2 |
| ATGGCCTGGTTCCCTCTCGTCCTCACCCTCCTCACTCACTGTGCAGGGTCCTGGGCC | 46 + 11 nt | IMGT | RHESUS-LBI47B |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-V63ZCXNDR/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases