RHESUS-V65GFZ36Y
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | True |
| Length | 270 nt |
| Protein UID i | RHESUS-VP-QFTI2P (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-V65GFZ36Y). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV3-24*02 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| NW_001099007.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGKV3-7*01 | 2015-03-19 |
External records i
NCBI nucleotide: link NCBI Gene: NCBIGENE:701244 GenBank: GENBANK:NW_001099007 IMGT: IGKV3-24*02
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 33048842 | Antimalarial antibody repertoire defined by plasma IG proteomics and single B cell IG sequencing. | name mentioned* | literature_supp |
| 34587480 | Paired heavy- and light-chain signatures contribute to potent SARS-CoV-2 neutralization in public antibody responses. | name mentioned* | literature_supp |
| 35383174 | Efficient human-like antibody repertoire and hybridoma production in trans-chromosomic mice carrying megabase-sized human immunoglobulin loci. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 37938344 | Role of affinity in plasma cell development in the germinal center light zone. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGAAACCCCAGCACAGCTTCTCTTCCTCCTGCTGCTCTGGCTCCCAGATACCACCGGA | 49 + 11 nt | IMGT | RHESUS-LBB4LG |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-V65GFZ36Y/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases