RHESUS-V6D5RGCCU
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 296 nt |
| Protein UID i | RHESUS-VP-VVDONA (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-V6D5RGCCU). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGHV4-117*01_S0312, IGHV4-S11_S0312. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV4-2ZSG*17 | IgLabel | MUSA |
| IGHV4-YE26*17 | IgLabel | OGRDB |
| IGHV4-117*01_S0312 | KIMDB | KIMDB |
| IGHV4-S11_S0312 | RhGLDB+ | RhGLDB+ |
External records i
OGRDB: IGHV4-YE26*17
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 35419009 | Addressing IGHV Gene Structural Diversity Enhances Immunoglobulin Repertoire Analysis: Lessons From Rhesus Macaque. | sequence in paper | literature_supp |
| 38707998 | Maintenance of caecal homeostasis by diverse adaptive immune cells in the rhesus macaque. | sequence in paper | literature_supp |
| 39068149 | Multi-compartmental diversification of neutralizing antibody lineages dissected in SARS-CoV-2 spike-immunized macaques. | sequence in paper | literature_supp |
Contributed by KIMDB, MUSA, OGRDB, RhGLDB+. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACC | MUSA | RHESUS-RXT2LD |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGAAGCACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGTGGGTCCTGTCC | 48 + 11 nt | MUSA | RHESUS-LIUYTJ |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-V6D5RGCCU/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
API: JSON · AIRR AlleleDescription · aliases