RHESUS-VAV3PAWK6
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV1-43MA*11_7atcc10_c14a_t19a_t21g_t25g_c27a_t34a_t40c_g43c_t44c_c51g_a58t_a64t_t66c_g72a_g75c_c79g_a80c_g81a_g83a_c84t_a85g_t87a_106catgg110_a112g_t114a_t115a_g118t_c120t_t124a_a125t_t126c_a128g_c130a_a131t_g132a_c137t_a138t_g140a_g141a_a142c_g145a_t146g_c147a_c149t_a151g_g153a_t155c_g159t_c162a_a164c_g166c_c170t_a171c_t193a_c195t_t198c_202gcccca207_g210t_t220g_a222c_a223c_t227a_g232a_g236a_t237g_a240g_t247a_c248g_g252c_255cagc258_260atgt263_c265t_c269g_c276t_a277g_g278a_a290g_a291g_t294c_t296c_299gggag303_t312c_c313a_a314t_g320a_t321c_327gtgg330_333aac335: a Macaca mulatta IGK V allele sequence, 287 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 287 nt |
| Protein UID i | RHESUS-VP-IS75DD (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VAV3PAWK6). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV0-I3R6*06 | IgLabel | OGRDB |
| IGKV1-43MA*11_7atcc10_c14a_t19a_t21g_t25g_c27a_t34a_t40c_g43c_t44c_c51g_a58t_a64t_t66c_g72a_g75c_c79g_a80c_g81a_g83a_c84t_a85g_t87a_106catgg110_a112g_t114a_t115a_g118t_c120t_t124a_a125t_t126c_a128g_c130a_a131t_g132a_c137t_a138t_g140a_g141a_a142c_g145a_t146g_c147a_c149t_a151g_g153a_t155c_g159t_c162a_a164c_g166c_c170t_a171c_t193a_c195t_t198c_202gcccca207_g210t_t220g_a222c_a223c_t227a_g232a_g236a_t237g_a240g_t247a_c248g_g252c_255cagc258_260atgt263_c265t_c269g_c276t_a277g_g278a_a290g_a291g_t294c_t296c_299gggag303_t312c_c313a_a314t_g320a_t321c_327gtgg330_333aac335 | VDJbase | MUSA |
External records i
OGRDB: IGKV0-I3R6*06
Contributed by MUSA, OGRDB. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACCGTGGTGCACCCTGTGCACAAAAC | MUSA | RHESUS-RG6QCW |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VAV3PAWK6/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases