RHESUS-VAZRCOTRT
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV7-3ZGD*01_i0ctcatgtaggttttaatttagcctctaccttg_a4c_t5a_t8a_g9a_a17t_c22t_c23t_25----t29_t32a_g34a_g39t_c41t_g48a_c49g_a52g_g55a_a58g_c60t_t62a_c65g_c66g_t67a_72---------------86_c93t_t100g_t101g_104----107_a109t_114gtgaa118_g122a_t124c_t126a_g129a_c130g_135------140_c145g_c146t_a153g_t162c_t163c_166ttgtt170_t193c_t198g_a201c_g202a_a203t_a205t_g209a_c214t_a216c_g220a_c221a_a223c_g224a_g225c_a229t_g230a_c231t_g233a_c234g_g238a_g239a_a253-_c255a_g256c_a262g_a271g_a274-_a275g_t276g_a285g_g289a_c291-_g292-_c296g_a300-_g301-_a302-_a305c_t306c_t307a_311----------------------332_c334a_c335g: a Macaca mulatta IGK V allele sequence, 273 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 273 nt |
| Protein UID i | RHESUS-VP-YGEKYY (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VAZRCOTRT). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV7-3ZGD*01_i0ctcatgtaggttttaatttagcctctaccttg_a4c_t5a_t8a_g9a_a17t_c22t_c23t_25----t29_t32a_g34a_g39t_c41t_g48a_c49g_a52g_g55a_a58g_c60t_t62a_c65g_c66g_t67a_72---------------86_c93t_t100g_t101g_104----107_a109t_114gtgaa118_g122a_t124c_t126a_g129a_c130g_135------140_c145g_c146t_a153g_t162c_t163c_166ttgtt170_t193c_t198g_a201c_g202a_a203t_a205t_g209a_c214t_a216c_g220a_c221a_a223c_g224a_g225c_a229t_g230a_c231t_g233a_c234g_g238a_g239a_a253-_c255a_g256c_a262g_a271g_a274-_a275g_t276g_a285g_g289a_c291-_g292-_c296g_a300-_g301-_a302-_a305c_t306c_t307a_311----------------------332_c334a_c335g | VDJbase | MUSA |
Contributed by MUSA. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CTCATGGCCAAGATGATACTGAAATC | MUSA | RHESUS-RPCRB5 |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VAZRCOTRT/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases