AIRBabel immunoglobulin and T-cell receptor allele sequences · leaders · RSSs

← back to search

RHESUS-VBYBQHKXA

AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.

SpeciesMacaca mulatta LocusIGH TypeV FunctionalFalse Length261 nt
SpeciesMacaca mulatta (NCBITAXON:9544)
Locus / typeIGH / V
Functional iFalse
Length261 nt
Protein UID iRHESUS-VP-3L5N2B (shared by alleles with the same V-REGION amino-acid sequence)

Allele names i

Every name below denotes this exact sequence (RHESUS-VBYBQHKXA). None is canonical; they are labels, and the UID is the key.

NameSchemeSource(s)
IGHV1-197*02 IgLabel MUSA
IGHV1-197*02 IMGT IMGT

Other names & identifiers

Alternative and former names, e.g. IMGT clone names, plus accession identifiers.

NameKindSource(s)
NW_001122023.1 NCBI accession ncbi_nucleotide

External records i

NCBI nucleotide: link NCBI Gene: NCBIGENE:720866 GenBank: GENBANK:NW_001122023 IMGT: IGHV1-197*02

Literature references 1 total · 1 name-mentioned* i

PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.

PMIDTitleEvidenceSource
35419009 Addressing IGHV Gene Structural Diversity Enhances Immunoglobulin Repertoire Analysis: Lessons From Rhesus Macaque. name mentioned* literature_supp

* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.

Contributed by IMGT, MUSA, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.

RSS i

Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.

PartSequenceSourceRSS UID
v_rsCACAGTGTGAAAACCCACATCCTGGGAGTGTCAGAAACC IMGT RHESUS-RR3KSP

Find similar alleles

Ranks coding alleles by normalized edit-distance identity. Also available at /api/sequences/RHESUS-VBYBQHKXA/similar?min_identity=0.95&kind=nt.

Coding sequence (nt)

261 nt
GAAGCCTGGGTCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACATCTTTACTAGCTCTGCTATGTAGTGGGTGCGACAGGCTCCTGGACAAGGCCTTGAGTGGATAGGAGTGATCATCATTGGCAATGGTAACACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACGTCCATGAGCACAGCCTACGTGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCAGA

Amino-acid sequence (V-REGION)

87 aa
EAWVLSEGLLQGFWIHLY*LCYVVGATGSWTRP*VDRSDHHWQW*HRLCTEVPGQSHHYQGHVHEHSLRGAEQPEIRGHGRVLLCGR

Translated here from the nucleotide sequence. A source publishes a different reference protein that these nucleotides do not encode; it is kept as an aa/imgt_reference_aa annotation rather than stored as the sequence. i