RHESUS-VDKV5X6TL
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV10-7UZD*01_a2g_g3a_g240c: a Macaca mulatta IGK V allele sequence, 305 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 305 nt |
| Protein UID i | RHESUS-VP-TA5IV2 (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VDKV5X6TL). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV0-7UZD*04 | IgLabel | OGRDB |
| IGKV10-7UZD*01_a2g_g3a_g240c | VDJbase | MUSA |
External records i
OGRDB: IGKV0-7UZD*04
Contributed by MUSA, OGRDB. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAATGGTACAGTCCTGAACACAAACC | MUSA | RHESUS-RWHB7F |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VDKV5X6TL/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases