RHESUS-VDNYYXKMC
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV3-53*02: a Macaca mulatta IGK V allele sequence, 287 nt, functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | True |
| Length | 287 nt |
| Protein UID i | RHESUS-VP-KGKARW (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
Name history i: formerly IGKV3-1*01 (to 2016-12-19);
Allele names i
Every name below denotes this exact sequence (RHESUS-VDNYYXKMC). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV3-ND5I*04 | IgLabel | MUSA |
| IGKV3-W5LH*04 | IgLabel | OGRDB |
| IGKV3-53*02 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| NW_001099007.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGKV3-1*01 | 2016-12-19 |
External records i
NCBI nucleotide: link NCBI Gene: NCBIGENE:701244 GenBank: GENBANK:NW_001099007 IMGT: IGKV3-53*02 OGRDB: IGKV3-W5LH*04
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 39068149 | Multi-compartmental diversification of neutralizing antibody lineages dissected in SARS-CoV-2 spike-immunized macaques. | sequence in paper | literature_supp |
| 28813462 | A comprehensive profiling of T- and B-lymphocyte receptor repertoires from a Chinese-origin rhesus macaque by high-throughput sequencing. | name mentioned* | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, MUSA, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGATTCAACTTGAAACAAAAACC | IMGT MUSA | RHESUS-R26QS3 |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGAAATCCCAGCTCAGCTTCTCTTCCTCCTGCTACTGTGGCTCCCAGGTACCACCGGA | 49 + 11 nt | IMGT | RHESUS-L4NDV3 |
| ATGGAAATCCCAGCTCAGCTTCTCTTCCTCCTGCTACTGTGGCTCCCAGGTGTACCACCGGA | 51 + 11 nt | MUSA | RHESUS-LD2QFW |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VDNYYXKMC/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases