RHESUS-VE7BBMDXB
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV3-7Y35*07_a3t_a7g_a9g_t11g_c14t_a15g_a17c_g18a_a28-_g33c_t34c_t37g_t42-_g46a_g48c_a51g_a54g_c56t_c61g_t64a_c75t_a76t_t78c_c79t_a80g_g83c_g85a_t87g_g107a_t112a_a113t_t115c_c119t_t138a_g141c_a143t_g144t_g145a_c149t_c150g_g153c_c154t_t155c_t158g_a160t_t161g_c162g_a164t_166ctgct170_t193c_a196c_a199t_g202a_204----atg210_a216t_a223t_t226g_t231g_t237c_g238a_t247c_g250-_g252a_g258t_t259g_c264t_c267g_a268g_g278a_t281a_g282a_i284t_g289t_a290c_t294g_t297a_a300t_t302c_304ccctc308_g311c_a314g_a317c_g318c_320tctc323_a325t_328acaa331_c333t_335ttccctagcaacggctctg353: a Macaca mulatta IGK V allele sequence, 299 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 299 nt |
| Protein UID i | RHESUS-VP-5H3J3E (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VE7BBMDXB). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV3-7Y35*07_a3t_a7g_a9g_t11g_c14t_a15g_a17c_g18a_a28-_g33c_t34c_t37g_t42-_g46a_g48c_a51g_a54g_c56t_c61g_t64a_c75t_a76t_t78c_c79t_a80g_g83c_g85a_t87g_g107a_t112a_a113t_t115c_c119t_t138a_g141c_a143t_g144t_g145a_c149t_c150g_g153c_c154t_t155c_t158g_a160t_t161g_c162g_a164t_166ctgct170_t193c_a196c_a199t_g202a_204----atg210_a216t_a223t_t226g_t231g_t237c_g238a_t247c_g250-_g252a_g258t_t259g_c264t_c267g_a268g_g278a_t281a_g282a_i284t_g289t_a290c_t294g_t297a_a300t_t302c_304ccctc308_g311c_a314g_a317c_g318c_320tctc323_a325t_328acaa331_c333t_335ttccctagcaacggctctg353 | VDJbase | MUSA |
Contributed by MUSA. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGGAGCTGCTAAGGGTCTGAAATC | MUSA | RHESUS-RRRKMT |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VE7BBMDXB/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases