RHESUS-VGK2RZZHH
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGKV7-ACH*01: a Macaca mulatta IGK V allele sequence, 299 nt, non-functional. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGK / V |
| Functional i | False |
| Length | 299 nt |
| Protein UID i | RHESUS-VP-5K4OVS (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: stable — no former names, re-cuts, or archival on record.
Allele names i
Every name below denotes this exact sequence (RHESUS-VGK2RZZHH). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGKV7-3ZGD*03 | IgLabel | MUSA, OGRDB |
| IGKV7-ACH*01 | RhGLDB+ | RhGLDB+ |
External records i
genbank:MF989473: GENBANK:MF989473 OGRDB: IGKV7-3ZGD*03
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29163486 | verified | MUSA | |
| 31080066 | verified | MUSA | |
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 38042809 | Interaction dynamics between innate and adaptive immune cells responding to SARS-CoV-2 vaccination in non-human primates. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by MUSA, OGRDB, RhGLDB+. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGCTTTAGGTCTAAACAAAAACC | MUSA | RHESUS-RK7LKU |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VGK2RZZHH/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases