AIRBabel immunoglobulin and T-cell receptor allele sequences · leaders · RSSs

← back to search

RHESUS-VILHGMWWE

AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.

StatusArchived · seen 2013-01-20 → 2020-01-31 SpeciesMacaca mulatta LocusIGH TypeV FunctionalNone Length299 nt RecordSuperseded

A newer source record exists for this allele designation. IGHV3-23*01 is still published by IMGT as RHESUS-VC2HDWVPA, 294 nt, whose bases differ from this one. This is the earlier record (299 nt, current in IMGT releases 2013-01-20–2020-01-31). The allele was not renamed and it was not withdrawn: IMGT changed the published sequence extent associated with this designation. Both extents are kept because a sequence is identified by its bases, so a change in extent is a different sequence.

SpeciesMacaca mulatta (NCBITAXON:9544)
Locus / typeIGH / V
Functional iNone
Length299 nt
Protein UID iRHESUS-VP-FEGZAB (shared by alleles with the same V-REGION amino-acid sequence)

Allele names i

None.

Other names & identifiers

Alternative and former names, e.g. IMGT clone names, plus accession identifiers.

NameKindSource(s)
MW177331.1 NCBI accession ncbi_nucleotide

Former IMGT names i

Former nameLast seen in IMGT release
IGHV3-23*012013-01-20

External records i

NCBI nucleotide: link

Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.

Find similar alleles

Ranks coding alleles by normalized edit-distance identity. Also available at /api/sequences/RHESUS-VILHGMWWE/similar?min_identity=0.95&kind=nt.

Coding sequence (nt)

299 nt
CAGGTGGCCAGTGTGAGTTGCTGCTGGTGGAGACTTGGTACAGCCCATGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATCCACCTTCAGTAGTTGCTGGATCAGCTGAATAGGCCAGGCTCCAGGGAAGGGGCTGCAGTGAGTAATAGATGTAAAGTACAATGGAAGAAAGACATACTAAGCAGACTCTGGGAAGGGCAGATTCACCGTCTCCAGAGACAACGCCAACAACTCGCTGTATCTGCAAATGAATAGTCTGAGAGCCAGACTTGGCCCTGTATTGTTGTGTGAAAGA

Amino-acid sequence (V-REGION)

99 aa
QVASVSCCWWRLGTAHGGP*DSPVQPLDPPSVVAGSAE*ARLQGRGCSE**M*STMEERHTKQTLGRADSPSPETTPTTRCICK*IV*EPDLALYCCVK

Translated here from the nucleotide sequence; no source published a protein for this allele. i