RHESUS-VMO5BB3UU
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 296 nt |
| Protein UID i | RHESUS-VP-UHHJJI (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-VMO5BB3UU). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 2 different allele designations: IGHV4-169*08, IGHV4-NL_1*02_S1821. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV4-36BV*34 | IgLabel | MUSA |
| IGHV4-5WKJ*03 | IgLabel | OGRDB |
| IGHV4-169*08 | IMGT | IMGT |
| IGHV4-NL_1*02_S1821 | KIMDB | KIMDB |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| MT542412.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link GenBank: GENBANK:MT542412 GenBank: GENBANK:MT542412.1 IMGT: IGHV4-169*08 OGRDB: IGHV4-5WKJ*03
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence.
Contributed by IMGT, KIMDB, MUSA, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACC | IMGT | RHESUS-RXT2LD |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGAAGCACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGGGTCCTGTCC | 46 + 11 nt | IMGT | RHESUS-LDRAVA |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VMO5BB3UU/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases