RHESUS-VNFNXJ5EA
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 296 nt |
| Protein UID i | RHESUS-VP-FKZ3MX (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-VNFNXJ5EA). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-23*03 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| AM940223.1 | NCBI accession | ncbi_nucleotide |
External records i
NCBI nucleotide: link IMGT: IGHV3-23*03
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 29558968 | BALDR: a computational pipeline for paired heavy and light chain immunoglobulin reconstruction in single-cell RNA-seq data. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 32636395 | IgCaller for reconstructing immunoglobulin gene rearrangements and oncogenic translocations from whole-genome sequencing in lymphoid neoplasms. | name mentioned* | literature_supp |
| 33485405 | Enhancement versus neutralization by SARS-CoV-2 antibodies from a convalescent donor associates with distinct epitopes on the RBD. | name mentioned* | literature_supp |
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | name mentioned* | literature_supp |
| 34781829 | Current strategies for detecting functional convergence across B-cell receptor repertoires. | name mentioned* | literature_supp |
| 34785098 | Landscapes and dynamic diversifications of B-cell receptor repertoires in COVID-19 patients. | name mentioned* | literature_supp |
| 36353774 | High activation levels maintained in receptor-binding domain-specific memory B cells in people with severe coronavirus disease 2019. | name mentioned* | literature_supp |
| 36827454 | Modeling and predicting the overlap of B- and T-cell receptor repertoires in healthy and SARS-CoV-2 infected individuals. | name mentioned* | literature_supp |
| 38435425 | Analysis of immunoglobulin/T-cell receptor repertoires by high-throughput RNA sequencing reveals a continuous dynamic of positive clonal selection in follicular lymphoma. | name mentioned* | literature_supp |
| 38643233 | An ancestral SARS-CoV-2 vaccine induces anti-Omicron variants antibodies by hypermutation. | name mentioned* | literature_supp |
| 39840032 | An allelic atlas of immunoglobulin heavy chain variable regions reveals antibody binding epitope preference resilient to SARS-CoV-2 mutation escape. | name mentioned* | literature_supp |
| 40664667 | High-resolution mapping of single cells in spatial context. | name mentioned* | literature_supp |
| 40710355 | Pathogenesis of Graves' Disease Determined Using Single-Cell Sequencing with Thyroid Autoantigen Peptide Stimulation in B Cells. | name mentioned* | literature_supp |
| 40841171 | Ultra-long sequencing for contiguous haplotype resolution of the human immunoglobulin heavy-chain locus. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACC | IMGT | RHESUS-R6AAZB |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VNFNXJ5EA/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
API: JSON · AIRR AlleleDescription · aliases