RHESUS-VOMFUBP2F
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGL / V |
| Functional i | True |
| Length | 290 nt |
| Protein UID i | RHESUS-VP-OYBVQ7 (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-VOMFUBP2F). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGLV3-2EX4*18 | IgLabel | MUSA |
| IGLV3-LFXG*15 | IgLabel | OGRDB |
| IGLV3-33*02 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| NW_001095158.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGLV3-2*01 | 2016-12-19 |
External records i
NCBI nucleotide: link GenBank: GENBANK:NW_001095158 IMGT: IGLV3-33*02 OGRDB: IGLV3-LFXG*15
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 28813462 | A comprehensive profiling of T- and B-lymphocyte receptor repertoires from a Chinese-origin rhesus macaque by high-throughput sequencing. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36611013 | Key changes in bovine milk immunoglobulin G during lactation: NeuAc sialylation is a hallmark of colostrum immunoglobulin G N-glycosylation. | name mentioned* | literature_supp |
| 38707998 | Maintenance of caecal homeostasis by diverse adaptive immune cells in the rhesus macaque. | name mentioned* | literature_supp |
| 41941497 | Pigs lacking Natural Killer T cells have altered cellular responses to influenza. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, MUSA, OGRDB, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGACACAGACAGATGGGGAAGTGAGACAGAAACC | IMGT MUSA | RHESUS-RJ775E |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGCCTGGACCCCTCCCCTGCTCATCCTCCTCACTCTCTGCACAGGTTCCGTGGTT | 46 + 11 nt | IMGT | RHESUS-LQDGFH |
| ATGGCCTGGACCCCTCCCCTGCTCATCCTCCTCACTCTCTGCACAGGTGTTCCGTGGTT | 48 + 11 nt | MUSA | RHESUS-LSFDHU |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VOMFUBP2F/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases