RHESUS-VP443FE2W
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
IGHV3-187*02: a Macaca mulatta IGH V allele sequence, 292 nt, not recorded. The nucleotide and amino-acid sequence is below, with every recorded name and its source.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / V |
| Functional i | None |
| Length | 292 nt |
| Protein UID i | RHESUS-VP-3HFU6Y (shared by alleles with the same V-REGION amino-acid sequence) |
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Translated here from the nucleotide sequence; no source published a protein for this allele. i
Name history i: formerly IGHV3-4*01 (to 2016-12-19);
Allele names i
Every name below denotes this exact sequence (RHESUS-VP443FE2W). None is canonical; they are labels, and the UID is the key.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV3-187*02 | IMGT | IMGT |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| PP648891.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGHV3-4*01 | 2016-12-19 |
External records i
NCBI nucleotide: link IMGT: IGHV3-187*02
Literature references i
PubMed publications linked to this allele. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 35419009 | Addressing IGHV Gene Structural Diversity Enhances Immunoglobulin Repertoire Analysis: Lessons From Rhesus Macaque. | name mentioned* | literature_supp |
| 36405682 | Primary antibody response after influenza virus infection is first dominated by low-mutated HA-stem antibodies followed by higher-mutated HA-head antibodies. | name mentioned* | literature_supp |
| 38707998 | Maintenance of caecal homeostasis by diverse adaptive immune cells in the rhesus macaque. | name mentioned* | literature_supp |
| 38961347 | Systematic characterization of immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic cod (Gadus morhua). | name mentioned* | literature_supp |
| 39068149 | Multi-compartmental diversification of neutralizing antibody lineages dissected in SARS-CoV-2 spike-immunized macaques. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 40338637 | Comprehensive analysis of nasal IgA antibodies induced by intranasal administration of the SARS-CoV-2 spike protein. | name mentioned* | literature_supp |
| 41392054 | Necessity of individual VDJ-databases for annotating antibody heavy chain characteristics in non-human primates. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGAGGAGAAGTCAATGTGAGCTCAGTCACAAACC | IMGT | RHESUS-RBXEYG |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| GTGGAGTTAGGAATGCACTGGGTTTTCTTTGCTATTGTTCTAAAAGGTGTCCAATGT | 46 + 11 nt | IMGT | RHESUS-L3S6CA |
Find similar (nt · aa · cross-species) i
Everything comparative about this sequence (the exact differences to other alleles, protein consequence, IMGT alignment, cross-species nearest) is shown per hit in the results of this query.
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VP443FE2W/similar?min_identity=0.95&kind=nt.
API: JSON · AIRR AlleleDescription · aliases