RHESUS-VQFPGTRID
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / V |
| Functional i | False |
| Length | 301 nt |
| Protein UID i | RHESUS-VP-Y3ND3H (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-VQFPGTRID). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 3 different allele designations: IGHV2-7*02_W5552, IGHV2-10*01, IGHV2-S3. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV2-7*02_W5552 | Guo | Guo |
| IGHV2-2YU6*05 | IgLabel | MUSA |
| IGHV2-V7ET*01 | IgLabel | OGRDB |
| IGHV2-10*01 | IMGT | IMGT |
| IGHV2-S3 | RhGLDB+ | RhGLDB+ |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| BK063715.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGHV2-2*01 | 2018-09-27 |
External records i
NCBI nucleotide: link GenBank: GENBANK:BK063715 GenBank: GENBANK:BK063715.1 IMGT: IGHV2-10*01 OGRDB: IGHV2-V7ET*01
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 25319573 | verified | MUSA | |
| 27525066 | verified | MUSA | |
| 31080066 | verified | MUSA | |
| 34875068 | verified | ncbi_nucleotide | |
| 35335026 | verified | ncbi_nucleotide | |
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 35419009 | Addressing IGHV Gene Structural Diversity Enhances Immunoglobulin Repertoire Analysis: Lessons From Rhesus Macaque. | sequence in paper | literature_supp |
| 29545810 | Repertoire Analysis of Antibody CDR-H3 Loops Suggests Affinity Maturation Does Not Typically Result in Rigidification. | name mentioned* | literature_supp |
| 31839985 | More than one antibody of individual B cells revealed by single-cell immune profiling. | name mentioned* | literature_supp |
| 34764956 | Novel Allele Detection Tool Benchmark and Application With Antibody Repertoire Sequencing Dataset. | name mentioned* | literature_supp |
| 34813501 | B cell receptor isotypes differentially associate with cell signaling, kinetics, and outcome in chronic lymphocytic leukemia. | name mentioned* | literature_supp |
| 36328595 | Myeloma immunoglobulin rearrangement and translocation detection through targeted capture sequencing. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 38961347 | Systematic characterization of immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic cod (Gadus morhua). | name mentioned* | literature_supp |
| 39127707 | Covalent penicillin-protein conjugates elicit anti-drug antibodies that are clonally and functionally restricted. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
| 41617721 | Refined phenotyping of vaccine responses reveals transcriptomic determinants of neutralizing antibody heterogeneity. | name mentioned* | literature_supp |
| 42078068 | B-cell immune repertoire analysis of autoimmune neurological syndromes with anti-GAD65 antibodies. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by Guo, IMGT, MUSA, OGRDB, RhGLDB+, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGAGACACAGCCCAGGGCGCCTCCTGTACAAGAACC | MUSA | RHESUS-R5MGF5 |
| v_rs | CACAGAGACACAGCTCAGGGCGCCTCCTGTACAAGAACC | IMGT MUSA | RHESUS-RSOBSS |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGACACGCTTTGCTCCACGCTCCTGCTGCTGACCGTCCCTTCATGTGGGTCTTCTCC | 48 + 11 nt | MUSA | RHESUS-LH2AIF |
| ATGGACACGCTTTGCTCCACGCTCCTGCTGCTGACCGTCCCTTCATGGGTCTTCTCC | 46 + 11 nt | IMGT | RHESUS-LQGPMH |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VQFPGTRID/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases