RHESUS-VSP2WGFMH
AIRBabel's deterministic identifier, minted from the sequence (SPECIES-CODE+hash) i: a stable sequence-derived identifier, not an official allele name. This sequence's names from each source are listed under Allele names.
| Species | Macaca mulatta (NCBITAXON:9544) |
|---|---|
| Locus / type | IGH / V |
| Functional i | True |
| Length | 296 nt |
| Protein UID i | RHESUS-VP-CVJTRM (shared by alleles with the same V-REGION amino-acid sequence) |
Allele names i
Every name below denotes this exact sequence (RHESUS-VSP2WGFMH). None is canonical; they are labels, and the UID is the key.
Multiple allele designations. This one sequence is recorded under 3 different allele designations: IGHV7-193*02, IGHV7-135*01, IGHV7-AAF*01. These are identical normalized nucleotide sequences with different attributed names.
| Name | Scheme | Source(s) |
|---|---|---|
| IGHV7-3Y2O*05 | IgLabel | MUSA |
| IGHV7-75KG*04 | IgLabel | OGRDB |
| IGHV7-193*02 | IMGT | IMGT |
| IGHV7-135*01 | KIMDB | KIMDB |
| IGHV7-AAF*01 | RhGLDB+ | RhGLDB+ |
Other names & identifiers
Alternative and former names, e.g. IMGT clone names, plus accession identifiers.
| Name | Kind | Source(s) |
|---|---|---|
| NW_001121240.1 | NCBI accession | ncbi_nucleotide |
Former IMGT names i
| Former name | Last seen in IMGT release |
|---|---|
| IGHV7-1*01 | 2020-01-31 |
External records i
genbank:MF989464: GENBANK:MF989464 NCBI nucleotide: link NCBI Gene: NCBIGENE:714939 GenBank: GENBANK:NW_001121240 IMGT: IGHV7-193*02 OGRDB: IGHV7-75KG*04
Literature references i
PubMed publications linked to this allele. A sequence-in-paper match indicates that this allele's exact sequence was detected in the publication text or supplementary material; it is sequence-level evidence. Name-mentioned entries were auto-collected by name match and may refer to a different same-named allele; treat them as leads, not ground truth.
| PMID | Title | Evidence | Source |
|---|---|---|---|
| 29163486 | verified | MUSA | |
| 31080066 | verified | MUSA | |
| 32866207 | Mapping the immunogenic landscape of near-native HIV-1 envelope trimers in non-human primates. | sequence in paper | literature_supp |
| 35419009 | Addressing IGHV Gene Structural Diversity Enhances Immunoglobulin Repertoire Analysis: Lessons From Rhesus Macaque. | sequence in paper | literature_supp |
| 36405682 | Primary antibody response after influenza virus infection is first dominated by low-mutated HA-stem antibodies followed by higher-mutated HA-head antibodies. | name mentioned* | literature_supp |
| 36473496 | Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination. | name mentioned* | literature_supp |
| 39698082 | Comprehensive method for producing high-affinity mouse monoclonal antibodies of various isotypes against (4-hydroxy-3-nitrophenyl)acetyl (NP) hapten. | name mentioned* | literature_supp |
| 41392054 | Necessity of individual VDJ-databases for annotating antibody heavy chain characteristics in non-human primates. | name mentioned* | literature_supp |
| 41410768 | Convergent mutation trajectories convert functional self-tolerance in IGHV4-34 B cells to genetic tolerance encoded in the antibody. | name mentioned* | literature_supp |
* matched by allele name only. The publication mentions this name, but AIRBabel cannot determine from the name alone whether it refers to this allele; the same name can denote a different allele in another species. This is useful for literature review but is not verified evidence.
Contributed by IMGT, KIMDB, MUSA, OGRDB, RhGLDB+, ncbi_nucleotide. See Sources & citations for each source's version, citation and licence.
RSS i
Recombination signal sequences flanking this allele. Click one to see every coding allele linked to that exact RSS variant.
| Part | Sequence | Source | RSS UID |
|---|---|---|---|
| v_rs | CACAGTGTGGAAACCCACATCCTGAGAGTGTCAGAAGCC | IMGT | RHESUS-RLWBR7 |
| v_rs | CACAGTGTGGAAACCCACATCCTGAGAGTGTCAGAAACC | MUSA | RHESUS-RQXYYE |
Leader
Signal-peptide coding sequence (spliced exon 1 + exon 2). The genomic intron between the two exons is deferred.
| Leader (exon 1 + exon 2) | Split | Source | Leader UID |
|---|---|---|---|
| ATGGACCTCACCTGGAGCATCCTTTTCTTGGTGGCAGCAGCAACATGTGCCCACTCC | 46 + 11 nt | IMGT | RHESUS-LCYAGB |
| ATGGACCTCACCTGGAGCATCCTTTTCTTGGTGGCAGCAGCAACATGTGTGCCCACTCC | 48 + 11 nt | MUSA | RHESUS-LEL4YR |
Find similar alleles
Ranks coding alleles by normalized edit-distance identity.
Also available at /api/sequences/RHESUS-VSP2WGFMH/similar?min_identity=0.95&kind=nt.
Coding sequence (nt)
Amino-acid sequence (V-REGION)
Published by the source, and consistent with the nucleotide sequence above. i
API: JSON · AIRR AlleleDescription · aliases